Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_circ_052372 | |||
Gene | TRIM28 | Organism | Human |
Genome Locus | chr19:59058742-59058878:+ | Build | hg19 |
Disease | Primary Biliary Cholangitis | ICD-10 | Cholangitis (K83.0) |
DBLink | Link to database | PMID | 29183005 |
Experimental Method | |||
Sample Type | Plasma sample | Comparison | 6 Primary Biliary Cholangitis (PBC) patients and 6 healthy controls |
Method for Estimation | Quantitative PCR and Microarrays | PCR Details | |
Primers (Experimented) | Forward TCAATGCCCACAAGGACCAC ReverseACAGTACGTTCACCATCCCGAG | Statistics | Fold Change : Upregulated,1.5998668 pvalue : p=0.00073809 |
Citation | |||
Zheng, J, Li, Z, Wang, T, Zhao, Y, Wang, Y (2017). Microarray Expression Profile of Circular RNAs in Plasma from Primary Biliary Cholangitis Patients. Cell. Physiol. Biochem., 44, 4:1271-1281. |